Глицин инструкция для детей 10 лет: Глицин инструкция по применению: показания, противопоказания, побочное действие – описание Glycine таб. подъязычные 100 мг: 50 шт. (4429)

Содержание

Глицин инструкция по применению: показания, противопоказания, побочное действие – описание Glycine таб. подъязычные 100 мг: 50 шт. (4429)

Способ применения и режим дозирования конкретного препарата зависят от его формы выпуска и других факторов. Оптимальный режим дозирования определяет врач. Следует строго соблюдать соответствие используемой лекарственной формы конкретного препарата показаниям к применению и режиму дозирования.

Применяют подъязычно или трансбуккально.

При психоэмоциональном напряжении, снижении памяти, внимания, умственной работоспособности, задержке умственного развития, при девиантных формах поведения назначают по 100 мг 2-3 раза/сут в течение 14-30 дней.

При функциональных и органических поражениях нервной системы, сопровождающихся повышенной возбудимостью, эмоциональной лабильностью и нарушением сна, детям до 3 лет назначают по 50 мг на прием 2-3 раза/сут в течение 7-14 дней, в дальнейшем по 50 мг 1 раз/сут 7-10 дней. Суточная доза — 100-150 мг, курсовая — 2000-2600 мг. Детям старше 3 лет и взрослым

назначают по 100 мг 2-3 раза/сут, курс лечения 7-14 дней. Курс лечения можно увеличить до 30 дней, при необходимости курс повторяют через 30 дней.

При нарушениях сна назначают за 20 мин до сна или непосредственно перед сном по 50-100 мг (в зависимости от возраста).

При ишемическом мозговом инсульте: в течение первых 3-6 ч от развития инсульта назначают 1000 мг, далее в течение 1-5 суток по 1000 мг/сут, затем в течение последующих 30 суток 50-100 мг 3 раза/сут.

В наркологии применяют в качестве средства, повышающего умственную работоспособность и уменьшающего психоэмоциональное напряжение в период ремиссии при явлениях энцефалопатии, органических поражениях центральной и периферической нервной системы

по 100 мг 2-3 раз/сут в течение 14-30 дней. При необходимости курсы повторяют 4-6 раз в год.

С какого возраста можно давать детям глицин и в каких дозах

Глицин — это известный и популярный медикамент, свойство которого заключается в регуляции обмена веществ, активизации процесса защитного торможения в центральной нервной системе (ЦНС) и снятии эмоционального напряжения. По-другому он называется аминоуксусная кислота. Это вещество признано безвредным для человека. 

Врачи выписывают Глицин для разного возраста по следующим показаниям:

  • нормализация сна;

  • избавление от тревожности;

  • активизация мозговой деятельности;

  • устранение беспокойства и раздражительности;

  • улучшение памяти;

  • повышение концентрации и внимания;

  • улучшение настроения;

  • повышение успеваемости в школе (для детей старше 6 лет). 

Кроме того, Глицин способен повышать уровень гормона роста (соматотропина). Это достигается за счет улучшения качества сна у детей после приема данного медикамента. Высвобождение соматотропина ускоряется именно в ночное время. Однако исследования таких особенности Глицина продолжаются, поэтому он пока активно используется для лечения задержки роста у детей.

Глицин детям нужно рассасывать, и в большинстве случаев это не вызывает трудностей, так как аминоуксусная кислота имеет сладкий привкус. Ребенку легче сублингвально (подъязычно) принять медикамент сладкого вкуса, чем выпить горькую микстуру или глотнуть таблетку. 

Рассматриваемый препарат по кровяному руслу транспортируется к головному мозгу и начинает активно действовать. Он не накапливается в организме и может помочь вывести из него токсины. 

Очень часто врачи выписывают Глицин для детей, которые учатся в школе и у них проблемы с успеваемостью из-за того, что они плохо запоминают новую информацию и не сконцентрированы. Также Глицин могут назначать ребенку, который по определенным причинам очень беспокойный и раздражительный или который плохо спит. 

Часто препарат применяют с маленького возраста. Единственным противопоказанием к применению является аллергия на компоненты состава, так как в состав кроме аминоуксусной кислоты входят вспомогательные вещества. 

Если после приема аминоуксусной кислоты в таблетированном виде у ребенка появляется красная сыпь, зуд, слабость и кружится голова, то лекарственное средство нужно прекратить принимать. Такие реакции свидетельствуют об аллергии на препарат. 

Но когда рекомендовано начинать принимать рассматриваемый медикамент и можно Глицин детям до года или его следует пить с более старшего возраста?

Чем нас лечат: Глицин — Индикатор

В ответ сайт производителей приводит такие аргументы:

  • Не проходит через гематоэнцефалический барьер? Ну и что, от препарата «нейроны мозга увеличивают собственный синтез» (чего, как, где исследования — информации нет), а еще в кишечнике тоже есть нервные клетки.
  • Нет выраженного результата при приеме? А его и не должно быть: Глицин — это «стимулятор обмена» и «витамин для мозга».
  • Не препарат, а БАД? Неправда, Глицин зарегистрирован как лекарство: «без подтвержденной эффективности данные о препарате не вносят в инструкцию», а значит, он прошел клинические испытания (публикаций результатов этих испытаний не приводится).

Мало того, что эти заявления противоречат друг другу, они еще и не подкреплены ссылками на клинические испытания. К тому же, как знают читатели нашей рубрики, регистрация в списках — хоть регистре лекарственных средств, хоть российском списке жизненно необходимых и важнейших лекарственных средств (который, кстати, был создан не для того, чтобы подтвердить, что лекарства работают, а чтобы ограничить их стоимость в продаже) — еще не гарантия эффективности. К тому же это в России Глицин — лекарство, в США, к примеру, он всего лишь БАД. А к билогически активным добавкам требования для регистрации гораздо ниже, да еще и спрос с них не так строг. А на сайте Управления по санитарному надзору за качеством пищевых продуктов и медикаментов (Food and Drug Administration, или FDA) США он значится как основа для применяющегося в урологических операциях раствора.

Сколько нужно глицина?

Забавно и такое уточнение: «Неправильное мнение о Глицине возникло из-за применения многочисленных БАДов, они содержат аминокислоту глицин и витамины. Разница между ними и медикаментами состоит в том, что для биодобавок не предусмотрены клинические исследования, а значит, эффективность их применения не имеет доказательств». Выходит, что Глицин отдельно — это лекарство, а с витаминами — уже добавка? Или, может, все дело в количестве?

Среднестатистическая диета включает около двух граммов глицина. Однако человеческий организм может синтезировать его и самостоятельно, используя другую аминокислоту, серин. Последнюю, кстати, тоже незаменимой не назовешь, так как и ее мы производим внутри себя. Но есть и данные в пользу того, что количество, в котором наш организм синтезирует глицин (три грамма в день) и в котором мы получаем его в с пищей (1,5-3 г), — это две трети от общей потребности. Учитывая «расходы» на синтез коллагена, где глицина используется очень много, человеку массой 70 кг нужно до десяти граммов глицина в день.

Допустим, от этого мы убедимся, что стоило бы есть побольше глицина. Но в таблетке Глицин содержится лишь 100 мг (0,1 г) одноименной аминокислоты. Сильно ли одна таблетка меняет ситуацию — казалось бы, вопрос риторический. На самом деле, при инсульте дневная дозировка составляет один-два грамма, так что это действительно может иметь смысл. Но есть ли от глицина какой-то значимый эффект на организм?

Пудра для полости рта и борьба с алкоголизмом

Ответить на этот вопрос помогут испытания на больших выборках пациентов. Правда, хоть упоминаний глицина в PubMed тысячи, среди них практически нет его клинических испытаний в качестве лекарства. Результаты таких работ разрозненные и чаще всего предварительные, дизайн их несовершенен. Ниже мы обсудим двойные слепые контролируемые исследования, которых среди тысяч экспериментов оказалось не так уж много.

Глицин — описание ингредиента, инструкция по применению, показания и противопоказания

Описание глицина

Глицин – это нейромедиаторная аминокислота, которая используется в медицине как ноотропное лекарственное средство.

Синоним – аминоуксусная кислота. Она присутствует в составе многочисленных белков. Из нее в клетках живых организмов синтезируются производные пурина.

Препараты глицина используются в терапии психических и невролгических заболеваний. В головном и спинном мозге есть глициновые рецепторы. Аминокислота прикрепляется к ним и оказывает «замедляющее» воздействие на нейроны, сокращает выработку из них «возбуждающих» аминокислот и усиливает выделение гамма-аминомасляной кислоты – главного тормозного нейромедиатора. Глицин – это природный антидепрессант и стабилизатор нервной системы.

Состав и форма выпуска глицина

Глицин выпускается в форме таблеток белого цвета.

В состав одного драже входит 100 мг активного вещества, 1 мг стеарата магния и 1 мг метилцеллюлозы.

Фармакологические свойства

Аминоуксусная кислота регулирует обменные процессы, которые активируют и приостанавливают защитное торможение в ЦНС. Препарат помогает поддерживать психическое и эмоциональное состояние в норме. Он снижает напряжение, тревожность и повышает интеллектуальные способности. Помимо этого, глицин:

  • повышает настроение;
  • облегчает засыпание;
  • улучшает качество сна;
  • снижает воздействие угнетающих ЦНС токсинов;
  • снимает стресс;
  • нормализует самочувствие;
  • успокаивает.

Действие на организм

Глицин нормализует деятельность мозга и восстанавливает нормальное функционирование нервной системы. Его можно принимать при наличии следующих состояний и болезней:

  • стрессовые ситуации;
  • ишемический инсульт;
  • неврозы и повышенная возбудимость;
  • вегетососудистая дистония;
  • энцефалопатия;
  • черепно-мозговые травмы.

Противопоказания и побочные эффекты

Относительными противопоказаниями к приему глицина являются беременность, грудное вскармливание.

Воздействие препарата на плод и новорожденного ребенка, находящегося на грудном вскармливании, пока не изучено, поэтому лучше отказаться от его применения.

Внимание! При гипотонии и одновременном приеме глицина нужно регулярно проверять артериальное давление. Если будут выявлены нарушения, следует скорректировать дозировку или заменить препарат на альтернативный.

Способы применения и дозировки

Глицин принимают сублингвально: кладут под язык и ждут полного растворения таблетки. Дозы и частота приема зависят от возраста человека, диагноза и клинической картины. Взрослые обычно употребляют по 1-2 таблетке в день на протяжении 30–90 суток. Затем делается как минимум трехмесячный перерыв, после чего можно возобновлять терапию. Детям препарат разрешен с 3 лет. Суточная доза не должна превышать 50% таблетки. Пьют это количество средства трижды в день не дольше 2 недель. По достижении ребенком 7 лет можно повысить дозу до целой таблетки или даже двух.

Внимание! Прием глицина во время беременности или лактации нужно осуществлять под контролем врача.

Отказ от ответсвенности

Обращаем ваше внимание, что вся информация, размещённая на сайте Prowellness предоставлена исключительно в ознакомительных целях и не является персональной программой, прямой рекомендацией к действию или врачебными советами. Не используйте данные материалы для диагностики, лечения или проведения любых медицинских манипуляций. Перед применением любой методики или употреблением любого продукта проконсультируйтесь с врачом. Данный сайт не является специализированным медицинским порталом и не заменяет профессиональной консультации специалиста. Владелец Сайта не несет никакой ответственности ни перед какой стороной, понесший косвенный или прямой ущерб в результате неправильного использования материалов, размещенных на данном ресурсе.

Протеин | kaup24.ee

Протеин

Протеин

— универсальная пищевая добавка к сбалансированной и разнообразной диете, которая повышает продуктивность спортивных тренировок. Самой популярной формой добавки является порошковый протеин в банках или пакетах, существуют также различные протеиновые коктейли, батончики, мюсли и другие продукты с высоким содержанием протеина. Большой выбор протеиновых добавок в разной форме предлагает наш интернет — магазин.

Протеиновые порошки, коктейли и батончики

Концентрат сывороточного протеина высшего качества с высокой биологической ценностью, содержащий пищеварительные ферменты, максимально легко усваивается и идеально подходит для наращивания мышечной массы.

Протеиновые коктейли с высококачественным трехкомпонентным молочным, сывороточным и соевым белком подходит активным людям и всем, кто хочет компенсировать дополнительные физические нагрузки. Протеиновые коктейли доступны с различными вкусами: шоколада, ягод, фруктов, орехов, кофе, ванили.

Протеиновые мюсли можно употреблять с молоком, йогуртом, творогом или фруктовым соком.

Порошковый протеиновый напиток с витаминами С, В2, РР, В6 и магнием подходит для ежедневного употребления для поддержания и увеличения объема мышц, помогает снизить симптомы усталости.

Протеиновый хлеб содержит меньше углеводов и больше белка, чем обычный хлеб. Этот продукт с ингредиентами премиум-класса напоминает аромат и вкус хлеба, но с низким содержанием калорий.

Купить протеин в Таллинне и других городах Эстонии онлайн

Ищете, где купить протеин для похудения? В электронном магазине Kaup24.ee в широком ассортименте вы найдете по разной цене протеин в разном виде таких известных производителей спортивного питания как 365JP, Biotech, Boost Yourself, Friendly Viking’s, Go Powders, ICONFIT, OstroVit, PRO!BRAND,S Puls Nutrition, Scitec Nutrition, TAKE-A-WHEY и многих других. Здесь можно выбрать протеиновый порошок в банках и пакетах разного объема, протеиновые коктейли, мюсли и хлеб с восхитительными вкусами шоколада и кофе, ванили и корицы, банана и клубники, манго и кокоса. Все товары в кратчайшие сроки доставляем по указанному адресу на всей территории Эстонии. Получить товар без дополнительной платы за доставку всегда можно в одном из наших физических магазинов.

Обзор, применение, побочные эффекты, меры предосторожности, взаимодействие, дозировка и обзоры

Баннай М., Каваи Н., Оно К., Накахара К., Мураками Н. Влияние глицина на субъективную дневную работоспособность у здоровых добровольцев с частичным ограничением сна. Фронт Нейрол. 2012 18 апр;3:61. Посмотреть реферат.

Баннаи М., Каваи Н. Новая терапевтическая стратегия аминокислотной медицины: глицин улучшает качество сна. J Pharmacol Sci. 2012;118(2):145-8. Посмотреть реферат.

Серон Э., Берналь-Алькантара Д., Ванда Б. и др.Прием глицина в течение шести месяцев не изменяет уровни инсулина, глюкозы или триглицеридов в плазме у здоровых крыс. Int J Vitam Nutr Res 2020: 1-10. Онлайн перед печатью. Посмотреть реферат.

де Конинг Т.Дж., Дюран М., Дорланд Л. и др. Благоприятные эффекты L-серина и глицина при лечении судорог при дефиците 3-фосфоглицератдегидрогеназы. Энн Нейрол 1998; 44: 261-5 .. Посмотреть аннотацию.

Диас-Флорес М., Крус М., Дюран-Рейес Г., Мунгия-Миранда С., Лоса-Родригес Х., Пулидо-Касас Э., Торрес-Рамирес Н., Гая-Родригес О., Кумате Дж., Байса-Гутман Л.А., Эрнандес- Сааведра Д.Пероральный прием глицина снижает окислительный стресс у пациентов с метаболическим синдромом, улучшая их систолическое артериальное давление. Может J Physiol Pharmacol. 2013 Октябрь; 91 (10): 855-60. Посмотреть реферат.

Evins AE, Fitzgerald SM, Wine L, et al. Плацебо-контролируемое исследование добавления глицина к клозапину при шизофрении. Am J Psychiatry 2000;157:826-8.. Посмотреть реферат.

File SE, Fluck E, Fernandes C. Благотворное влияние глицина (биоглицина) на память и внимание у молодых людей и людей среднего возраста.J Clin Psychopharmacol 1999;19:506-12. . Посмотреть реферат.

Фрайс М.Х., Ринальдо П., Шмидт-Зоммерфельд Э. и др. Изовалериановая ацидемия: реакция на лейциновую нагрузку после трех недель приема глицина, L-карнитина и комбинированной терапии глицин-карнитином. J Pediatr 1996;129:449-52.. Посмотреть реферат.

Гринвуд Л.М., Леунг С., Мичи П.Т. и др. Влияние глицина на негативность слухового несоответствия при шизофрении. Шизофр Рез. 2018;191:61-69. Посмотреть реферат.

Гусев Э.И., Скворцова В.И., Дамбинова С.А., и др.Нейропротекторные эффекты глицина при лечении острого ишемического инсульта. Cerebrovasc Dis 2000;10:49-60. Посмотреть реферат.

Харви С.Г., Гибсон Дж.Р., Берк, Калифорния. L-цистеин, глицин и dl-треонин при лечении гипостатической язвы на ногах: плацебо-контролируемое исследование. Pharmatherapy 1985;4:227-30.. Посмотреть аннотацию.

Хереско-Леви У., Джавитт Д.С., Ермилов М. и др. Двойное слепое плацебо-контролируемое перекрестное исследование адъювантной терапии глицином при резистентной к лечению шизофрении.Br J Psychiatry 1996;169:610-7.. Посмотреть реферат.

Хереско-Леви У., Джавитт Д.С., Ермилов М. и др. Эффективность высоких доз глицина при лечении стойких негативных симптомов шизофрении. Arch Gen Psychiatry 1999; 56: 29-36 .. Посмотреть аннотацию.

Инагава К., Хираока Т., Кода Т., Ямадера В., Такахаши М. Субъективное влияние приема глицина перед сном на качество сна. Сон и биологические ритмы. 2006 г.; 4:75-77.

Инагава К., Каваи Н., Оно К., Сукегава Э., Цубуку С., Такахаши М.Оценка острых побочных эффектов приема глицина в высоких дозах у добровольцев. Сэйкацу Эйсей. 2006 г.; 50:27-32.

Джавитт Д.К., Балла А., Сершен Х., Лайта А.Э. Премия Беннета за исследования. Реверсирование эффектов, вызванных фенциклидином, глицином и ингибиторами транспорта глицина. Biol Psychiatry 1999;45:668-79.. Посмотреть реферат.

Javitt DC, Zylberman I, Zukin SR, et al. Улучшение негативных симптомов при шизофрении глицином. Am J Psychiatry 1994;151:1234-6.. Посмотреть реферат.

Манейките Дж., Баусис А., Лебер Б. и др. Диетический глицин предотвращает повреждение сердца, вызванное химиотерапией FOLFOX: модель лечения метастазов колоректального рака в печень у крыс. Питательные вещества 2020;12(9):2634. Посмотреть реферат.

Oshima S, Shiiya S, Nakamura Y. Влияние комбинированного лечения глицином и триптофаном на снижение уровня мочевой кислоты в сыворотке у субъектов с легкой гиперурикемией: рандомизированное двойное слепое плацебо-контролируемое перекрестное исследование. Питательные вещества 2019;11(3). пий: E564. Посмотреть реферат.

Potkin SG, Jin Y, Bunney BG, Costa J, Gulasekaram B. Влияние клозапина и дополнительных высоких доз глицина на резистентную к лечению шизофрению. Am J Psychiatry 1999;156:145-7.. Посмотреть аннотацию.

Роуз М.Л., Каттли Р.С., Данн С. и др. Диетический глицин предотвращает развитие опухолей печени, вызванных пролифератором пероксисом WY-14,643. Carcinogenesis 1999;20:2075-81.. Посмотреть реферат.

Роуз М.Л., Мадрен Дж., Бунзендаль Х., Турман Р.Г. Пищевой глицин подавляет рост опухолей меланомы B16 у мышей.Канцерогенез 1999;20:793-8.. Посмотреть реферат.

Сугая К., О-Ока Х., Ямада Т. и др. Диетический глицин улучшает симптомы накопления мочи у амбулаторных урологических пациентов. J Complement Integr Med 2021. Онлайн перед печатью. Посмотреть реферат.

Турман Р.Г., Чжун З., фон Франкенберг М. и др. Профилактика нефротоксичности, вызванной циклоспорином, с помощью диетического глицина. Transplantation 1997;63:1661-7.. Посмотреть реферат.

Варгас М.Х., Дель-Разо-Родригес Р., Лопес-Гарсия А. и др. Влияние перорального глицина на клинический, спирометрический и воспалительный статус у пациентов с муковисцидозом: пилотное рандомизированное исследование.BMC Пульм Мед. 2017;17(1):206. Посмотреть реферат.

Вудс С.В., Уолш Б.К., Хокинс К.А., Миллер Т.Дж., Сакса М.Р., Д’Суза Д.С., Перлсон Г.Д., Джавитт Д.К., МакГлашан Т.Х., Кристал Д.Х. Лечение глицином синдрома риска развития психоза: отчет о двух пилотных исследованиях. Евро Нейропсихофармакол. 2013 авг; 23 (8): 931-40. Посмотреть реферат.

Yamadera W, Inagawa K, Chiba S, Bannai M, Takahashi M, Nakayama K. Прием внутрь глицина улучшает субъективное качество сна у добровольцев, коррелируя с полисомнографическими изменениями.Сон и биологические ритмы. 2007 г.; 5:126-131.

Yin M, Ikejima K, Arteel GE, Seabra V и др. Глицин ускоряет восстановление после алкогольного повреждения печени. J Pharmacol Exp Ther 1998;286:1014-9.. Посмотреть реферат.

Zhong Z, Arteel GE, Connor HD и др. Циклоспорин А увеличивает гипоксию и образование свободных радикалов в почках крыс: профилактика с помощью диетического глицина. Am J Physiol 1998;275:F595-604.. Посмотреть реферат.

Глициновая энцефалопатия | Информационный центр генетических и редких заболеваний (GARD) – программа NCATS

Глициновая энцефалопатия  – это наследственное метаболическое заболевание, характеризующееся аномально высоким уровнем аминокислоты, называемой глицином.Глицин — это химический мессенджер, передающий сигналы в мозг. [1] [2] В зависимости от симптомов начала заболевания глициновую энцефалопатию можно разделить на: [3] [2]
  • несколько дней жизни и может включать плохое питание, недостаток энергии (вялость), слабый мышечный тонус (гипотония), икоту, проблемы с дыханием, судороги, икоту и кому.
  • Детская форма: симптомы проявляются только после 6-месячного возраста в виде умственной отсталости, аномальных движений и поведенческих проблем
  • Позднее начало: симптомы включают скованность или ригидность ног или рук (спастическая диплегия) и потерю зрения из-за повреждения глазного нерва (атрофия зрительного нерва).
  • Транзиторная форма: симптомы аналогичны классической форме, но уровень глицина снижается, и со временем симптомы могут улучшиться.
Глициновая энцефалопатия вызывается изменениями (мутациями) в генах AMT , GLDC или GCSH , которые приводят к дефициту фермента, расщепляющего глицин. Диагноз основывается на симптомах, высоком уровне глицина и дефиците фермента, а также на генетическом тестировании. Наследование аутосомно-рецессивное. [2] [1] Лечение может включать бензоат натрия для снижения уровня глицина, антагонисты рецепторов N-метил-D-аспартата (NMDA), противосудорожные препараты и кетогенную диету. [1] Около половины детей с классической формой умирают в течение нескольких недель жизни, а у выживших может наблюдаться задержка моторики, очень маленькая голова, судороги и ригидность. В транзиторной форме симптомы могут улучшаться со временем. [3]

 

Последнее обновление: 18.11.2017

Технический бюллетень по глифосату

С 2011 года NPIC прекратил создание информационных бюллетеней по пестицидам.Старая коллекция технических информационных бюллетеней останется доступной в этом архиве, но они могут содержать устаревшие материалы. NPIC больше не имеет возможности постоянно обновлять их. Чтобы просмотреть наши общие информационные бюллетени, нажмите здесь. Актуальные технические информационные бюллетени можно найти на веб-странице Агентства по охране окружающей среды.

Лабораторные испытания: перед регистрацией пестицидов Агентства по охране окружающей среды США, они должны пройти лабораторные испытания на краткосрочные (острые) и долгосрочные (хронические) последствия для здоровья.Лабораторным животным намеренно вводят достаточно высокие дозы вызывать токсические эффекты. Эти тесты помогают ученым судить о том, насколько эти химические вещества могут воздействовать на людей, домашних животных, и диких животных в случаях чрезмерного воздействия.

Молекулярная структура —
Глифосат

Химический класс и тип:

  • Глифосат представляет собой неселективный системный гербицид, применяемый непосредственно к листве растений. 1 При использовании в меньших количествах глифосат может действовать как регулятор роста растений. 2 Глифосат представляет собой производное глицина. 1 Международный союз чистых и прикладных Химическое (IUPAC) название глифосата — N-(фосфонометил). глицин 3 и регистрационный номер Chemical Abstracts Service (CAS) 1071-83-6. 1
  • О потенциале глифосата как гербицида сообщалось в 1971 г. 1,4 Глифосат был первым зарегистрирован для использования Агентством по охране окружающей среды США (US EPA) в 1974 г. 5 , а перерегистрация завершена в 1993 г. 6 См. текстовое поле Лабораторные испытания .
  • Составы глифосата включают кислоту, моноаммониевую соль, диаммоний соль, соль изопропиламина, соль калия, соль натрия и триметилсульфоний или тримезий поваренная соль. 1,2,4 Если не указано иное, все данные в этом информационном бюллетене относятся к кислоте форма.
  • Глифосат технического качества используется в составах продуктов, как и изопропиламин, соли натрия и моноаммония.Из них соль изопропиламина является наиболее обычно используется в готовых продуктах. 2,7

Физические/химические свойства:

Глифосат и связанные формы
Активный ингредиент Форма 1,4 Давление пара 1,4,8 Постоянная Генри 8 Молекулярная масса 1,4,8 Растворимость в воде (мг/л) 1,4 Журнал К вл 1,4,8 К ок 3
Глифосатная кислота белые твердые вещества без запаха 1.31 x 10 -2 мПа (25 °C)
1,84 x 10 -7 мм рт.ст. (45 °C)
4,08 x 10 -19 атм·м 3 /моль 169,07 г/моль рН 1,9: 10 500 мг/л
рН 7,0: 157 000 мг/л
Менее -3,2 300 — 20 100
Соль изопропиламина глифосата белые твердые вещества без запаха 2,1 x 10 -3 мПа (25 °C)
1.58 x 10 -8 мм рт.ст. (25 °C)
6,27 x 10 -27 атм·м 3 /моль 228,19 г/моль рН 4,06: 786 000 мг/л -3,87 или -5,4 300 — 20 100
Аммониевая соль глифосата белые твердые вещества без запаха 9 x 10 -3 мПа (25 °C)
6,75 x 10 -8 мм рт.ст. (25 °C)
1,5 x 10 -13 атм·м 3 /моль 186.11 г/моль рН 3,2: 144 000 мг/л -3,7 или 5,32 300 — 20 100

Использование:

  • Глифосат является одним из наиболее широко используемых гербицидов, применяемых в сельском хозяйстве, лесное хозяйство, промышленная борьба с сорняками, газон, сад и водная среда. 1,6 Участки с наибольшим использованием глифосата включают соевые бобы, полевые кукурузы, пастбища и сено. 2,6
  • Некоторые растения были генетически модифицированы, чтобы быть устойчивыми к глифосату.Устойчивые к глифосату соевые бобы, кукуруза, хлопок, и рапс являются примерами таких растений. 4,9 Этот информационный бюллетень не касается культур, устойчивых к глифосату.
  • Использование отдельных продуктов, содержащих глифосат, широко варьируется. Всегда читайте и следуйте инструкциям на этикетке при применении пестицидов. продукты.
  • Сигнальные слова для продуктов, содержащих глифосат, могут варьироваться от «Осторожно» до «Опасно». Сигнальное слово отражает комбинированное токсичность активного ингредиента и других ингредиентов в продукте.См. этикетку пестицида на изделии и см. информационные бюллетени NPIC по сигнальным словам и инертным или «другим» ингредиентам.
  • Чтобы найти список продуктов, содержащих глифосат, которые зарегистрированы в вашем штате, посетите веб-сайт http://npic.orst.edu/reg/state_agencies.html выберите свой штат, затем щелкните ссылку «Продукты штата».

Способ действия:

Целевые организмы
  • В растениях глифосат разрушает метаболический путь шикимовой кислоты за счет ингибирования фермента 5-энолпирувилшикимат-3-фосфата (EPSP) синтаза.Возникающий в результате дефицит продукции EPSP приводит к уменьшению количества ароматических аминокислот, которые необходим для синтеза белка и роста растений. 1,4
  • Глифосат всасывается через листья и стебли растений и перемещается по всему растению. 1,3 Концентраты в ткани меристемы. 10
  • Растения, подвергшиеся воздействию глифосата, демонстрируют задержку роста, потерю зеленой окраски, сморщивание или деформацию листьев и ткани смерть.Гибель растения может занять от 4 до 20 дней. 4,10
  • Натриевая соль глифосата может действовать как регулятор роста растений и ускорять созревание определенных культур. 2
Нецелевые организмы
  • Путь шикимовой кислоты специфичен для растений и некоторых микроорганизмов. Отсутствие этого пути у млекопитающих может объясняют низкую токсичность глифосата для нецелевых организмов. 11,12
  • Исследования показывают, что поверхностно-активное вещество полиоксиэтиленамин или полиэтоксилированный амин таллового жира (оба сокращенно POEA), используется в некоторых коммерческих препаратах на основе глифосата, может быть более токсичным при пероральном введении для животных, чем глифосат сам. 13,14
  • Механизм токсичности глифосата у млекопитающих неизвестен, но это может вызвать разобщение окислительного фосфорилирования. 15 Однако эта гипотеза была оспорена. 16

Острая токсичность:

Оральный
  • Глифосат малотоксичен для крыс при приеме внутрь. острый пероральная LD 50 у крыс превышает 4320 мг/кг. 17 См. текстовые поля по классификации токсичности и LD 50 /LC 50 .

    LD 50 /LC 50 : Общий мерой острой токсичности является смертельная доза (LD 50 ) или смертельная концентрация (LC 50 ), вызывающая смерть (в результате от однократного или ограниченного воздействия) у 50 процентов пролеченных животные. LD 50 обычно выражается как доза в миллиграммы (мг) химического вещества на килограмм (кг) тела масса. LC 50 часто выражается в мг химического вещества на объем (т.г., литр (л)) среды (т. е. воздуха или воды) организма подвергается. Химические вещества считаются высокотоксичными, если LD 50 /LC 50 имеет небольшой размер и практически не токсичен. когда значение велико. Однако LD 50 /LC 50 не отражает каких-либо последствий длительного воздействия (т. е. рака, врожденные дефекты или репродуктивная токсичность), которые могут возникать при уровнях ниже те, которые вызывают смерть.

  • Острая пероральная ЛД 50 для крыс также превышала 5000 мг/кг.Острая пероральная ЛД 50 превышала 10 000 мг/кг у мышей и 3530 мг/кг у коз. 1
  • Соль изопропиламина имеет очень низкую токсичность для крыс, LD 50 превышает 5000 мг/кг. 1
  • Острая пероральная ЛД 50 соли аммония составляет 4613 мг/кг для крыс. 1
  • Острая пероральная ЛД 50 в трех лекарственных препаратах колебалась от 3860 до более чем 5000 мг/кг у крыс. 4
Кожный
  • Глифосат малотоксичен для кроликов при нанесении на кожу.Острая кожная LD 50 у кроликов превышает 2 г/кг. 17
  • Глифосат имеет низкую токсичность при раздражении глаз и очень низкую токсичность при раздражении кожи. В исследованиях с производством глифосата продуктов, исследователи наблюдали легкое раздражение глаз у кроликов, которое исчезло через семь дней. 18,19
  • Глифосат не является кожным сенсибилизатором. 6
  • Соли изопропиламина и аммония также малотоксичны при попадании на кожу.LD 50 у кроликов превышала 5000 мг/кг для обеих солей, и эти соли считаются легкими раздражителями глаз, но не раздражителями кожи. 1
  • Из трех испытанных продуктов раздражение кожи варьировалось от нулевого до умеренного, а раздражение глаз оценивалось как отсутствие, умеренная и тяжелая. Кожные значения LD 50 у кроликов, подвергшихся воздействию этих продуктов, превышали 5000 мг/кг. 4
  • Готовый продукт Roundup®, содержащий 41% глифосата, был нанесен на кожу 204 добровольцев мужского и женского пола. в модифицированном тесте Дрейза.Сенсибилизации не наблюдалось. Исследователи пришли к выводу, что воздействие не приведет к фотораздражению. или фотосенсибилизация. 20
Вдыхание
  • Глифосат очень малотоксичен для крыс при вдыхании. Острое вдыхание LC 50 у крыс превышает 4,43 мг/л на основе 4-часовое исследование ингаляции только через нос. 21
  • 4-часовая ЛК 50 для крыс, подвергшихся воздействию изопропиламиновой формы глифосата, была больше 1.3 мг/л воздуха. 1
  • LC 50 для крыс, подвергшихся воздействию аммонийной соли глифосата, превышала 1,9 мг/л при воздействии на все тело. 1
  • Вдыхание LC 50 Значения для двух составов превышали 1,3 мг/л и 3,2 мг/л у крыс. 4
КЛАССИФИКАЦИЯ ТОКСИЧНОСТИ — ГЛИФОЗАТ
Высокая токсичность Умеренная токсичность Низкая токсичность Очень низкая токсичность
Острый пероральный LD 50 До 50 мг/кг включительно
(≤ 50 мг/кг)
От 50 до 500 мг/кг
(>50-500 мг/кг)
От 500 до 5000 мг/кг
(>500-5000 мг/кг)
Более 5000 мг/кг
(>5000 мг/кг)
Вдыхание LC 50 До 0 включительно.05 мг/л
(≤0,05 мг/л)
Более 0,05–0,5 мг/л
(>0,05–0,5 мг/л)
Более 0,5–2,0 мг/л
(>0,5–2,0 мг/л)
Более 2,0 мг/л
(>2,0 мг/л)
Кожный LD 50 До 200 мг/кг включительно
(≤200 мг/кг)
От более 200 до 2000 мг/кг
(>200-2000 мг/кг)
Более 2000 до 5000 мг/кг
(>2000-5000 мг/кг)
Более 5000 мг/кг
(>5000 мг/кг)
Первичное раздражение глаз Разъедающее (необратимое разрушение ткани глаза) или поражение роговицы или раздражение, сохраняющееся более 21 дня Поражение роговицы или другое раздражение глаз проходит через 8–21 день Поражение роговицы или другое раздражение глаз проходит в течение 7 дней или менее Минимальное устранение эффектов менее чем за 24 часа
Первичное раздражение кожи Разъедающее (разрушение тканей в дерме и/или рубцевание) Сильное раздражение через 72 часа (сильная эритема или отек) Умеренное раздражение через 72 часа (умеренная эритема) Легкое или слабое раздражение через 72 часа (без раздражения или эритема)
Выделенные поля отражают значения в разделе «Острая токсичность» данного информационного бюллетеня. По образцу Агентства по охране окружающей среды США, Управления программ по пестицидам, Руководства по проверке этикеток, глава 7: Предупредительная маркировка. https://www.epa.gov/sites/default/files/2018-04/documents/chap-07-mar-2018.pdf
Признаки токсичности — животные
  • У животных, подвергшихся воздействию гербицидов на основе глифосата, наблюдались анорексия, вялость, гиперсаливация, рвота и диарея. Симптомы сохранялись от 2 до 24 часов после воздействия. Считается, что поверхностно-активные вещества в готовых продуктах нести ответственность за клинические признаки. 22
  • Клинические признаки обычно появляются в течение от 30 минут до 2 часов после приема внутрь. Животные могут проявлять возбудимость и тахикардию. сначала с последующими атаксией, депрессией и брадикардией. Тяжелые случаи могут прогрессировать до коллапса и судорог. 15
  • Ветеринарная информационная служба по отравлениям в Лондоне, Англия, зарегистрировала 150 случаев заражения собак за 8-летний период. к глифосату в первую очередь от употребления в пищу травы, недавно обработанной рецептурными продуктами.Из них примерно 40% собак клинические признаки отсутствовали, у 45% были клинические признаки от легкой до умеренной степени тяжести, и примерно 15% были классифицированы как серьезные. 15
  • Национальный центр токсикологической и ветеринарной информации Франции сообщил о 31 конкретном случае интоксикации домашних животных. животных препаратами, содержащими глипосат, в 3-летний период. Большинство контактов произошло в результате проглатывания животными продукт перед нанесением. Из этих случаев 25 были собаки и 4 кошки.Рвота возникает в течение 1-2 часов после приема в 61% случаев. Гиперсаливация наблюдалась в 26% случаев, а легкая диарея — в 16% случаев. Центр в записях не сообщалось о долгосрочных последствиях или каких-либо смертельных случаях. 23
Признаки токсичности для человека
  • В обзоре 80 случаев преднамеренного приема пищи, 79 из которых были попытками самоубийства, исследователи выявили типичные симптомы эрозии желудочно-кишечного тракта, дисфагии или затрудненного глотания и желудочно-кишечного кровотечения.Семь случаев привело к смерти. 24 Случайное проглатывание вызывает легкие желудочно-кишечные расстройства. 14
  • Иногда сообщалось о раздражении глаз и кожи в результате воздействия на кожу составов глифосата. 13,14 Однако, неблагоприятные последствия для здоровья, как правило, связаны с воздействием, которое происходит при смешивании концентрированного продукта, а не с использованием разбавленных растворов для опрыскивания. 13 Постоянное повреждение глаз или кожи встречается очень редко. 13,14,25
  • Вдыхание аэрозольного тумана может вызвать дискомфорт во рту или носу, а также покалывание и раздражение горла. 14
  • Всегда следуйте инструкциям на этикетке и принимайте меры для минимизации воздействия. Если произошло какое-либо воздействие, обязательно следуйте инструкциям по оказанию первой помощи. инструкции на этикетке продукта внимательно. Для получения дополнительных рекомендаций по лечению обратитесь в Центр контроля отравлений по телефону 1-800- 222-1222. Если вы хотите обсудить инцидент с Национальным информационным центром по пестицидам, позвоните по телефону 1-800-858-7378.

Хроническая токсичность:

Животные
  • Исследователи давали гончим собакам капсулы, содержащие 0, 20, 100 или 500 мг/кг/день глифосата в течение одного года. Эффектов не наблюдалось; NOEL для системной токсичности больше или равен 500 мг/кг/день. 26 См. текстовое поле NOAEL, NOEL, НУНВ и НУНВ .

    NOAEL: отсутствие наблюдаемых побочных эффектов, уровень

    NOEL: отсутствие наблюдаемого эффекта, уровень

    LOAEL: Самый низкий уровень наблюдаемых побочных эффектов

    LOEL: Самый низкий уровень наблюдаемого эффекта

  • Самцов крыс кормили рационом, содержащим глифосат в дозах 89, 362 или 940 мг/кг/день, а самок кормили аналогичными концентрациями 113, 457 или 1183 мг/кг/день в течение 2 лет.В женской группе, принимавшей высокие дозы, исследователи наблюдали снижение увеличение веса. В группе мужчин, принимавших высокие дозы, исследователи наблюдали снижение рН мочи, увеличение признаков катаракты и аномалии хрусталика и увеличение веса печени. Никаких эффектов не наблюдалось в группах с низкой и средней дозой. LOEL для системной токсичности составил 940 и 1183 мг/кг/день для мужчин и женщин соответственно. То NOEL для системной токсичности составляет 362 мг/кг/день для мужчин и 457 мг/кг/день для женщин. 27
  • Лабораторных крыс кормили рационом, содержащим глифосат в дозах 0, 100, 300 или 1000 мг/кг/день в течение двух лет.Через 52 недели некоторые крысы в две группы с самой высокой дозой имели увеличенные слюнные железы с клеточными изменениями. Установлено, что NOEL составляет 100 мг/кг/день. 28
  • На основании серии тестов не предполагается, что глифосат обладает иммунотоксичностью или нейротоксичностью. Лабораторных мышей кормили рационом, содержащим глифосат, в течение 28 дней. NOAEL для иммунотоксичности был определен как 1448 мг/кг/день. 29 Установлено, что NOAEL для субхронической нейротоксичности у крыс составляет 1546.5 и 1630,6 мг/кг/сутки для мужчин и женщин соответственно. 30
  • Допустимая суточная доза (ADI) комбинации глифосата и некоторые метаболиты (AMPA, N-ацетилглифосат и N-ацетилAMPA) для человека составляет 1,0 мг/кг. В 2011 г. международное расчетное суточное потребление (IEDI) глифосата и основных метаболитов оценивается в диапазоне от 0-2% от ДСД. 31,32
  • Хроническая референтная доза глифосата составляет 1.75 мг/кг/день. 33 См. текстовое поле на Эталонная доза (RfD) .
Люди
  • Исследователи собирали образцы мочи в течение 8 месяцев у рабочих двух лесных питомников, где глифосат использовался для борьба с сорняками. Ни в одном из 355 образцов мочи глифосат не был обнаружен. Исследователи объясняют отсутствие обнаруженных глифосата в образцах мочи рабочих к плохой абсорбции глифосата через кожу. 34 См. текстовое поле Экспозиция .

    Воздействие: воздействие глифосата на здоровье человека и окружающую среду зависит от того, насколько наличие глифосата, а также продолжительность и частота воздействия. Эффекты также зависят от здоровья человека и/или определенных факторов внешней среды.

  • Пять работников лесного хозяйства распыляли глифосат по 6 часов в день в течение недели. Нет статистически значимых различий были обнаружены в ходе медицинских осмотров и лабораторных анализов, проведенных у рабочих после применения пестицидов. 35
  • Исследователи собрали образцы мочи у фермерских семей в Южной Каролине и Миннесоте в рамках программы Farm Family Exposure. Изучать. В день подачи заявки у 60% фермеров обнаруживаемый уровень глифосата в моче составлял не менее 1 части на миллиард. Среднее геометрическое обнаруженного глифосата составило 3 части на миллиард с максимальным значением 233 частей на миллиард. Средние концентрации в моче глифосата были выше у фермеров, которые не использовали резиновые перчатки во время обработки. 36

Нарушение эндокринной системы:

  • Крыс и мышей кормили рационом, содержащим 0, 3125, 6250, 12 500, 25 000 или 50 000 частей на миллион 99% чистого глифосата в течение 13 недель.В двух группах самцов крыс, получавших самые высокие дозы, наблюдалось значительное снижение концентрации сперматозоидов, хотя концентрации все еще находились в пределах исторического диапазона для этой линии крыс. Группа самок крыс, получавших самую высокую дозу, имела немного более продолжительную течку. цикла, чем в контрольной группе. 37
  • Исследователи изучили научную литературу о глифосате, его основном метаболите AMPA, в составе продуктов Roundup®. производства Monsanto и поверхностно-активное вещество POEA. Они не обнаружили никаких доказательств эндокринных эффектов у людей или других животных. млекопитающие. 13
  • Согласно результатам программы EPA по исследованию эндокринных разрушителей (EDSP), глифосат не считается эндокринным разрушителем из-за отсутствия потенциального взаимодействия с эстрогенными, андрогенными или тиреоидными путями. 38

Канцерогенность:

Животные
  • Исследователи кормили крыс пищей, содержащей глифосат в количестве 0, 89, 362 или 940 мг/кг/день (самцы) и 0, 113, 457 или 1183 мг/кг/день. (самки) в течение двух лет.Высокая доза в этом исследовании приближается или превышает предельную дозу, рекомендованную для исследований канцерогенности. В некоторых случаях наблюдалось небольшое увеличение аденом островковых клеток поджелудочной железы, гепатоцеллюлярных аденом и аденом С-клеток щитовидной железы. Ни один из этих результатов не был статистически значимым. Частота возникновения опухолей находилась в пределах диапазона исторического контроля (исторические контрольные данные за семь лет лабораторных исследований) для оцениваемых типов опухолей в этом исследовании. Агентство по охране окружающей среды США пришло к выводу, что опухоли не связаны с лечением. 27,39
  • В исследовании канцерогенности мышам давали диету, содержащую глифосат (0, 161/195, 835/968, 4945/6069 мг/кг/день для самцов и самок соответственно) в течение 24 месяцев. Умеренные и высокие дозы в этом исследовании превышают или приближаются к предельной дозе, рекомендованной для исследований канцерогенности. В группах с высокими дозами исследователи наблюдали снижение прибавки массы тела как у самцов, так и у самок мышей. У мужчин, получавших высокие дозы, было отмечено незначительное увеличение частоты аденом почечных канальцев.Более поздняя повторная оценка тканей показала, что опухоли почек не связаны с воздействием глифосата. Независимая группа патологоанатомов и биометристов также пришла к выводу, что возникновение аденом не было вызвано глифосатом. Исследования ткани почек выявили хронический интерстициальный нефрит и тубулярную эпителиальную базофилию и гипертрофию у самцов крыс. В целом у самцов мышей не наблюдалось увеличения поражений канальцев. 39,40,41
  • В исследовании канцерогенности самцам и самкам крыс давали глифосат технического качества в их рационе (0, 95, 316.9 и 1229,7 мг/кг/сутки). У самок крыс отмечено незначительное увеличение опухолей молочной железы. Заболеваемость опухолью не была статистически значимой в попарных сравнениях. 39
  • Золотая рыбка ( Carassius auratus ) подверглась воздействию 5, 10 или 15 частей на миллион составного продукта Roundup®, содержащего IPA соль глифосата и ПАВ ПОЭА в течение 6 дней. Исследователи отметили повышенное повреждение ДНК и микроядер в периферические эритроциты. Это могло быть результатом снижения репарации ДНК.Результаты тестов на генотоксичность, как правило, неоднозначны. хотя приготовленные продукты, по-видимому, с большей вероятностью вызывают эффекты, чем один глифосат. 42
  • Глифосат подвергался многочисленным тестам на генотоксичность, и результаты в подавляющем большинстве случаев отрицательные. 31 Дозы, показавшие положительные результаты in vivo , были слишком высокими, чтобы их можно было считать подходящими для оценки риска для здоровья человека. 39
Люди
  • У.S. EPA классифицировало глифосат как «маловероятно канцерогенный для человека». Канцерогенный потенциал человека оценивали путем анализа имеющихся эпидемиологических данных, данных о канцерогенности животных и генотоксичности. 30,39 См. текстовое поле Рак .

    Рак: правительственные учреждения в Соединенных Штатах и ​​за рубежом разработали программы для оценки способность химического вещества вызывать рак. Рекомендации по тестированию и системы классификации различаются. Узнать больше о значении различных дескрипторов классификации рака, перечисленных в этом информационном бюллетене, пожалуйста, посетите соответствующую ссылку или позвоните в NPIC.

  • Органы по регулированию пестицидов в Канаде, Японии, Австралии и Европейском Союзе завершили независимые оценки канцерогенности, результаты которых аналогичны определениям канцерогенности, что и Агентство по охране окружающей среды США. 43,44,45,46 Национальная токсикологическая программа Национального института здравоохранения США также не обнаружила «никаких доказательств того, что глифосат вызывает повреждение ДНК». 47 Совместное совещание по остаткам пестицидов Продовольственной и сельскохозяйственной организации Объединенных Наций и оценка Всемирной организации здравоохранения определили, что глифосат вряд ли представляет канцерогенный риск при воздействии через пищу. 48
  • Классифицировано Международным агентством по изучению рака (IARC) глифосат отнесен к группе 2А, ​​«вероятно, канцерогенный для человека». 49
  • Исследователи проанализировали источник различий между классификациями рака IARC и Европейского агентства по безопасности пищевых продуктов (EFSA). Оценки IARC направлены на выявление канцерогенных опасностей, в то время как EFSA также включило уровни ожидаемого воздействия в нормативное определение. Оценка IARC включала только исследования, которые были доступны в опубликованной литературе.Кроме того, оценка EFSA включала пять исследований канцерогенности на животных, опубликованных после монографии IARC. 50 Исследования, использованные в определении IARC, включали исследования как с активным ингредиентом технического качества, так и с рецептурными продуктами, содержащими глифосат. 49
  • Обзор канцерогенных оценок IARC и EFSA выявил различия в процессе отбора исследований, включая использование EFSA исторических контрольных данных и исключение исследований, не соответствующих рекомендациям, и эффекты, наблюдаемые при дозах, превышающих предельную дозу или максимально переносимую дозу. (МТД). 51
  • Исследователи изучили научную литературу о глифосате, его основном метаболите AMPA, в составе продуктов Roundup®. производства Monsanto и поверхностно-активное вещество POEA. Они обнаружили, что Roundup® и его компоненты не вызывают мутаций. или образование опухоли. Исследователи пришли к выводу, что глифосат не является канцерогенным. 13
  • Исследователи оценили взаимосвязь воздействие-реакция между использованием продуктов, содержащих глифосат, и раком у 57 311 лицензированных специалистов по применению пестицидов, участвующих в исследовании здоровья сельского хозяйства.Воздействие глифосата не было связано с общей заболеваемостью раком или большинством подтипов рака. В небольшом числе случаев была «предполагаемая ассоциация». между воздействием глифосата и заболеваемостью множественной миеломой. 52
  • Дополнительные обзоры данных по АЧЛ и другие эпидемиологические исследования не выявили последовательной связи между глифосатом и солидными опухолями, лейкемией, лимфомой Ходжкина и множественной миеломой. Имеющихся данных недостаточно, чтобы поддержать выводы об ассоциации между глифосатом и неходжкинской лимфомой. 39

Репродуктивные или тератогенные эффекты:

Животные
  • В исследовании развития беременным кроликам давали глифосат через зонд (желудочный зонд) на 7-19 дни беременности в дозах 0, 100, 175, 300 мг/кг/день. У кроликов в средних и более высоких дозах была диарея или мало и/или не было фекалий. Кролики были наиболее чувствительными из протестированных видов животных с УННВВ для развития, равным 300 мг/кг/день. На основании этого исследования на кроликах хроническое пищевое и случайное воздействие NOAEL и LOAEL составляют 100 и 175 мг/кг/день соответственно. 30
  • Исследователи вводили беременным крысам глифосат через зонд (желудочный зонд) на 6-19 дни беременности в дозах 0, 300, 1000 или 3500 мг/кг/день. При самой высокой дозе они обнаружили снижение прибавки массы тела как у самок, так и у плодов. повышенная материнская смертность и увеличение числа аномалий скелета плода. NOEL для материнства и развития токсичность составляла 1000 мг/кг/день, а LOEL — 3500 мг/кг/день. 30,53
  • В исследовании развития ученые подвергали беременных кроликов воздействию глифосата через зонд на 6-27 дни беременности в дозах 0, 75, 175 или 350 мг/кг/день.Они не обнаружили никаких эффектов развития. При самой высокой испытанной дозе животные демонстрировали диарея, выделения из носа и повышенная смертность; слишком много животных погибло в этой группе, чтобы оценить влияние на развитие в эта доза. NOEL для материнских эффектов составил 175 мг/кг/день. 30,54
  • После изучения токсикологической базы данных Агентство по охране окружающей среды не обнаружило доказательств повышенной восприимчивости молодых крыс и кроликов к внутриутробному воздействию глифосата. 30
  • Пищевые концентрации глифосата до 10 000 частей на миллион или 293 мг/кг/день, вводимые крысам в течение двух поколений, не влияние на мужскую или женскую сексуальность и фертильность.NOAEL для родительской и потомственной токсичности составляет 3000 частей на миллион, исходя из снижение массы тела при 10 000 ppm. 31,55
  • Исследователи изучили научную литературу о глифосате, его основном метаболите AMPA, в составе продуктов Roundup®. производства Monsanto и поверхностно-активное вещество POEA. Они пришли к выводу, что ни глифосат, ни AMPA, ни POEA не вызывали репродуктивные эффекты в различных исследованиях на животных. 13
Люди
  • Анкеты, заполненные операторами фермы и подходящими парами, собранные во время исследования здоровья семьи на ферме Онтарио. предположил, что существует связь между воздействием пестицидов, содержащих глифосат, до зачатия и повышенный риск позднего самопроизвольного аборта. 56

Судьба в теле:

Поглощение
  • Исследования на животных показали, что 30-36% глифосата всасывается после приема внутрь. 11,13,57
  • Всасывание глифосата через кожу плохое. 6 Эксперимент in vitro с кожей человека дал максимум 2,2% от 2,6 мкг/см 2 глифосат впитывался через кожу. Пик абсорбции достигается через 8 часов после приема. 58
  • Исследователи нанесли глифосат на кожу живота обезьян в дозах 5400 мкг или 500 мкг на 20 см 2 кожи.Более 7 сутки на коже оставалось 73,5% и 77,1% нанесенной дозы. 58
  • Глифосат нелетуч. 6 Ожидается, что абсорбция при вдыхании будет незначительной. 14
Распределение
  • Крысы, которым перорально вводили 10 мг/кг глифосата, достигали максимальной концентрации в тканях через 6 часов после введения дозы. То содержимое желудочно-кишечного тракта составило 50% дозы, при этом на ткань тонкой кишки приходится дополнительная 18%.Приблизительно 5 % дозы было обнаружено в костях и 6 % в туше, при этом 1 % или менее дозы было распределено к абдоминальному жиру, крови, толстой кишке, почкам, печени и желудку. 57
  • Исследователи давали крысам однократную пероральную дозу 10 мг/кг или 1000 мг/кг глифосата. Через семь дней после введения поглощенная доза распределялась по всему телу, хотя в основном концентрировалась в костях. 59
  • Исследователи кормили кур и коз глифосатом и обнаружили глифосат и его основной метаболит AMPA в яйцах, молоке и тканей тела животных. 13,60,61
Метаболизм
  • Глифосат подвергается незначительному метаболизму и выводится в основном в неизмененном виде с калом и вторично с мочой. 3,13,62
  • Образцы, взятые у коз и кур, которых кормили глифосатом, содержали исходное соединение и АМФК, но не было доказательств других метаболитов глифосата в тканях организма, яйцах или молоке. 6
  • Высокие отношения глифосата к AMPA были обнаружены в сыворотке крови пациента через 8 часов (22.6 мкг/мл глифосата до 0,18 мкг/мл AMPA) и через 16 часов (от 4,4 мкг/мл глифосата до 0,03 мкг/мл AMPA) после приема внутрь, а также в общем количестве у пациента мочи. Это указывает на то, что метаболизм глифосата был минимальным. 63
Выделения
  • Исследования на животных показывают, что глифосат в основном выводится с мочой и фекалиями. 3,13,62
  • Крыса, получившая однократную пероральную дозу глифосата, вывела 0,27% введенной дозы в виде диоксида углерода и вывела 97.5% в виде глифосата в моче и фекалиях. Исследователи обнаружили AMPA в моче (0,2-0,3% введенной дозы) и фекалиях. (0,2-0,4% от введенной дозы). 64,65
  • Глифосат выводится из организма крыс через 168 часов после введения. 11
  • У двух пациентов, отравившихся глифосатом, пиковые концентрации глифосата в плазме были обнаружены в течение 4 часов после проглатывание. Через 12 часов глифосат практически не обнаруживался. 66

Медицинские тесты и мониторинг:

  • Воздействие глифосата можно контролировать путем измерения концентраций глифосата и AMPA в крови или моча. 11,67,68 Методы обнаружения включают газовую хроматографию и высокоэффективную жидкостную хроматографию. 63,68,69 Однако, клиническое значение остатков в тканях человека неизвестно.
  • Исследователи разработали мультиплексный флуоресцентный ковалентный иммуноферментный анализ с микрошариками с повышенной чувствительностью (FCMIA). для измерения глифосата в моче. 70 Этот метод использовался для обнаружения глифосата в исследовании среди фермерских и нефермерских домохозяйств в Айове. 71

Экологическая судьба:

Почва
  • Медианный период полураспада глифосата в почве широко изучался; в литературе сообщалось о значениях от 2 до 197 дней. 7,62 Было предложено типичное время полураспада в полевых условиях 47 дней. 4 Почва климатические условия влияют на стойкость глифосата в почве. 1 См. текстовое поле Half-life .

    «Период полураспада» — это время, необходимое для половины соединение разрушается в окружающей среде.

    1 период полураспада = 50% оставшихся
    2 периода полураспада = 25% оставшихся
    3 периода полураспада = 12% оставшихся
    4 периода полураспада = 6% оставшихся
    5 периодов полураспада = 3% оставшихся

    Периоды полураспада могут широко варьироваться в зависимости от окружающей среды. факторы. Количество химикатов, оставшееся после период полувыведения всегда будет зависеть от количества изначально примененное химическое вещество. Необходимо отметить, что некоторые химические вещества могут разлагаться на соединения токсикологическое значение.

  • Глифосат относительно устойчив к химическому и фоторазложению. 6 Основным путем деградации глифосата являются почвенные микробы. действие, которое дает AMPA и глиоксиловую кислоту. Оба продукта далее разлагается до углекислого газа. 3
  • Глифосат прочно впитывается в почву. Ожидается, что глифосат и его остатки быть неподвижным в почве. 6
Вода
  • Средний период полураспада глифосата в воде варьируется от нескольких дней до 91 день. 1
  • Глифосат не подвергался гидролизу в буферном растворе с pH 3, 6 или 9 при 35 °C. Фотодеградация глифосата в воде была незначительна при естественном освещении в буферном растворе с рН 5, 7 и 9. 72,73
  • Глифосат в виде препарата Раундап® наносили на водные растения в пресной и солоноватой воде. глифосат концентрации в обоих прудах быстро снижались, хотя связывание глифосата с донными отложениями сильно зависело от на металлы в осадках.Если присутствуют хелатирующие катионы, период полураспада глифосата в осадке может значительно увеличиться. повысился. 74
  • Глифосат имеет низкий потенциал загрязнения подземных вод благодаря своим сильным адсорбционным свойствам. Однако есть потенциальное загрязнение поверхностных вод в результате водного использования глифосата и эрозии почвы. 6
  • Ожидается, что испарение глифосата будет незначительным из-за его низкого давления паров. 6
Воздух
  • Глифосат и все его соли имеют очень низкую летучесть с давлением паров в диапазоне от 1.84 х 10 -7 мм рт.ст. до 6,75 x 10 -8 мм рт.ст. при 25 °C. 1,4,8
  • Глифосат стабилен на воздухе. 1
Растения
  • Глифосат поглощается листвой растений и транспортируется по всему растению через флоэму. 3 Абсорбция глифосата через кутикулу является умеренным, а транспорт через клеточную мембрану медленнее, чем у большинства гербицидов. 4 Потому что глифосат связывается с почвой, поглощение растениями глифосата из почвы незначительно. 3
  • Глифосат накапливается в меристемах, незрелых листьях и подземных тканях. 4
  • В растениях метаболизируется очень мало глифосата, при этом AMPA является единственным продуктом значительного разложения. 3
  • Салат, морковь и ячмень содержали остатки глифосата в течение года после обработки почвы 3,71 фунта глифосата на акр. 75,76
  • Медианный период полураспада глифосата в опаде листьев красной ольхи и лососевой, обработанных Roundup®, составлял от 8 до 9 дней. 62
Внутренний
  • Все образцы пыли и салфеток с поверхностей, собранные в пяти фермерских хозяйствах в Айове, содержали обнаруживаемые уровни глифосата. в пределах 0,0081-2,7 нг/см 2 . В шести нефермерских домохозяйствах 28 из 33 собранных образцов содержали обнаруживаемые уровни глифосат от 0,0012 до 13 нг/см 2 . 77
Пищевые остатки
  • Глифосат не был включен в состав соединений, проверенных Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA). Программа мониторинга (PRMP), ни в Программе данных о пестицидах (PDP) Министерства сельского хозяйства США.

Исследования экотоксичности:

Птицы
  • Исследование острой пероральной токсичности показало, что однократная доза глифосата технического качества практически не токсична для бобовых перепелов с LD 50 более 2000 мг/кг. 78
  • Исследования с глифосатом технического качества показали, что 8-дневная диетическая ЛК 50 превышает 4000 частей на миллион у кряквы и белой белянки. перепелов, что указывает на легкую токсичность. 78,79
  • Не ожидается, что глифосат вызовет нарушения репродуктивной функции у птиц при содержании в рационе до 1000 частей на миллион. 6
  • Оценка экологического риска показала, что наибольший риск для птиц представляет глифосат и продукты на его основе. и другие дикие животные возникают в результате изменения среды обитания. 7
Рыба и водные обитатели
  • Глифосат технического сорта варьируется от слаботоксичного до практически нетоксичного для пресноводных рыб, с 48-часовой ЛК 50 от 24 мг/л до 140 мг/л. 6
  • Препараты глифосата варьируются от умеренно токсичных до практически нетоксичных для пресноводных рыб, с 96-часовой ЛК 50 значения от 1.от 3 мг/л до более чем 1000 мг/л. 6
  • Препарат поверхностно-активного вещества POEA, известный как MON 0818, используется в некоторых составах глифосата. 7 POEA умеренно токсичен для очень высокотоксичен для пресноводных рыб. 96-часовые значения LC 50 варьировались от 0,65 мг/л до 13 мг/л. Продукты, содержащие На этикетке указано MON 0818: «Этот пестицид токсичен для рыб». 6
  • ЛК 50 глифосата для радужной форели ( Onchorynchus mykiss ) составляла 140 мг/л для жирноголового гольяна ( Pimephales promelas ) составлял 97 мг/л, для канального сома ( Icalurus punctatus ) — 130 мг/л, а для синежаберной солнечной рыбы ( Lepomis macrochirus ) — 150 мг/л. мг/л.Когда они подвергались воздействию Roundup®, LC 50 с для этих же рыб составляли 8,3, 2,4, 13,0 и 6,4 мг/л соответственно. 80
  • Технический глифосат слабо токсичен или практически не токсичен для пресноводных беспозвоночных, с 48-часовой ЛК 50 в диапазоне от 55 частей на миллион до 780 частей на миллион. 6 48-часовая ЛК 50 для дафний составляла 3,0 мг/л, а ЛК 50 для личинок мошек составляла 16 мг/л при подвергшихся воздействию разработанного продукта Roundup®. 80
  • Исследователи рассчитали значения LC 50 для четырех видов земноводных (леопардовая лягушка ( Rana pipiens ), лесная лягушка ( R. sylvatica ), зеленая лягушка ( R. clamitans ) и американская жаба ( Bufo americanus )) подвергались воздействию оригинального Roundup® препарат глифосата. 24-часовые значения LC 50 для разных видов колебались от 6,6 до 18,1 мг/л. 81
  • Зеленые лягушки ( р.clamitans ) подвергались воздействию технического глифосата в виде соли изопропиламина, поверхностно-активного вещества POEA и шесть составов продуктов, содержащих глифосат. Поверхностно-активное вещество было наиболее токсичным для R. clamitans с 24- и 96-кратным час LC 50 1,1 мг/л (95% ДИ 1,1–1,2) и 1,1 мг/л (95% ДИ 1,0–1,1) соответственно. Наименее токсичным оказался технический глифосат. 24 и 96 часов LC 50 >38,9 г/л. Токсичность приготовленных продуктов находилась между этими значениями. 81
  • Исследование хронической токсичности глифосата технического качества показало снижение репродуктивной способности у Daphnia magna с максимально допустимой концентрацией токсиканта от 50 до 96 ppm. 82
  • Глифосат технический практически не токсичен или слабо токсичен для эстуариев и морские организмы. 96-часовая LC 50 составляет 281 ppm для травяных креветок ( Palaemonetas vulgaris ) и 934 ppm для краб-скрипач ( Uca pagilator ). 83 Среднее время летального исхода за 48 часов (TL 50 ) превышает 10 мг/л для атлантической устрицы ( Crassostrea virginica ). 84
Наземные беспозвоночные
  • Исследования показывают, что как технический, так и готовый глифосат практически нетоксичен для медоносных пчел при остром пероральном и острый контакт LD 50 значения более 100 мкг/пчела. 85
  • Оценка экологического риска Roundup® показала, что наибольший риск для членистоногих связан с измененной средой обитания. Структура и доступность пищи. 7
  • Дождевой червь LC 50 в почве превышает 5000 частей на миллион для разработанного Monsanto продукта Roundup®. 4

Нормативная база:

Референтная доза (RfD): RfD – это оценка количества химическое вещество, которому человек может подвергаться каждый день для отдыха их жизни без заметного риска неблагоприятных последствий для здоровья. То референтная доза обычно измеряется в миллиграммах (мг) химического на килограмм (кг) массы тела в сутки.

Агентство по охране окружающей среды США, Глоссарий записной книжки по влиянию на здоровье, 2019 г. https://www.epa.gov/haps/health-effects-notebook-glossary

  • Агентство по охране окружающей среды США классифицировало глифосат как «маловероятно канцерогенный для человека». 30,39
  • Референтная доза (RfD) глифосата составляет 1,75 мг/кг/день. 33 См. текстовое поле на Эталонная доза (RfD) .
  • Допустимая суточная доза (ДСП) комбинации глифосата и некоторые метаболиты (AMPA, N-ацетилглифосат и N-ацетилAMPA) для человек 1.0 мг/кг. 31,32

    Максимальный уровень загрязнения (MCL): MCL является самым высоким допустимый уровень загрязнения питьевой воды. MCL подлежит принудительному исполнению. MCL обычно измеряется в миллиграммы (мг) загрязнителя на литр (л) воды.

    Агентство по охране окружающей среды США, Национальные правила первичной питьевой воды, 2019 г. https://www.epa.gov/ground-water-and-drinking-water/national-primary-drinking-water-regulations#one

  • У.S. EPA установило однодневную дозу 20 мг/л. 86
  • Агентство по охране окружающей среды США установило десятидневную дозу 20 мг/л. 86
  • Максимальный уровень загрязнения (ПДК) составляет 0,7 мг/л. 86 См. текстовое поле Максимальный уровень загрязнения (MCL) .

Дата проверки: сентябрь 2010 г.; внесены ограниченные изменения: март 2019 г.

Пожалуйста, указывайте как: Henderson, A.M.; Жерве, Дж. А.; Луукинен, Б.; Буль, К .; Стоун, Д.; Стрид, А.; Кросс, А .; Jenkins, J. 2010. Технический бюллетень по глифосату ; Национальный пестицид Информационный центр Службы распространения знаний Университета штата Орегон. http://npic.orst.edu/factsheets/archive/glyphotech.html.

Глицин для лечения психотических расстройств у детей — Просмотр полного текста может обеспечить эффективное лечение аугментации устойчивых к нейролептикам негативных симптомов шизофрении.До десяти детей и подростков в возрасте от 9 до 18 лет, отвечающих критериям DSM-IV в отношении шизофрении, шизоаффективного расстройства и психотического расстройства, не уточненного иным образом, с началом психоза к 12 годам, у которых по крайней мере два предыдущих антипсихотических препарата, включенных в этот протокол, не дали эффекта на текущий антипсихотический препарат лекарства будут участвовать в открытом 8-недельном испытании дополнительной терапии глицином. В дополнение к потенциальным преимуществам, если терапия глицином улучшит устойчивые негативные симптомы шизофрении, мы ожидаем, что доступность этого нового лечения облегчит набор этих редких пациентов.

В этом исследовании будут представлены экспериментальные данные о благотворном влиянии и безопасности дополнительной терапии глицином у детей и подростков с рефрактерными психотическими расстройствами. Доступность новых альтернативных методов лечения также важна для привлечения пациентов к более широкому изучению нейробиологии и генетики шизофрении с очень ранним началом.

К участию в исследовании допускаются дети и подростки в возрасте от девяти до восемнадцати лет. Субъекты, входящие в протокол в качестве новых пациентов, будут охарактеризованы клинической феноменологией, отслеживанием глаз, МРТ головного мозга, спинномозговой жидкостью, биохимией плазмы и мочи и хромосомным анализом.Пациентам с выраженными симптомами настроения, которым потребовалось добавление стабилизаторов настроения, таких как литий или вальпроевая кислота, будет разрешено продолжать прием этих препаратов в течение всего периода лечения, если это будет клинически показано. Биохимический анализ печени будет проверяться на исходном уровне и в конце исследования.

Все родственники первой степени родства опрашиваются лично, проходят измерение слежения за глазами и предоставляют линии клеток крови в рамках генетического исследования когорты (84-M-0050).

Фенотипический спектр у пациента с мутацией глицина в серин в гене COL2A1: обзорное исследование

[1] Kannu P, Bateman J, Savarirayan R (2012)Клинические фенотипы, связанные с мутациями коллагена II типа. J Paediatr Child Health  48: E38-43. doi: 10.1111/j.1440-1754.2010.01979.x
[2] Spranger J, Winterpacht A, Zabel B (1994)Коллагенопатии II типа: спектр хондродисплазии. Eur J Pediatr  153: 56–65.
[3] Цао Л.Х., Ван Л., Цзи С.И. и др. (2012)Новые и рецидивирующие мутации COL2A1 у китайских пациентов со спондилоэпифизарной дисплазией. Genet Mol Res  11: 4130-4137. doi: 10.4238/2012.сентябрь 27.1
[4] Deng H, Huang X, Yuan L (2016)Молекулярная генетика заболеваний, связанных с COL2A1. Mutat Res Rev Mutat Res  768: 1–13. doi: 10.1016/j.mrrev.2016.02.003
[5] Ненна Р., Турчетти А., Мастроджорджио Г. и др. (2019) Мутации гена COL2A1: механизмы врожденной спондилоэпифизарной дисплазии. Appl Clin Genet  12: 235-238. DOI: 10.2147/TACG.S197205
[6] Нисимура Г., Хага Н., Кито Х. и др.(2005) Фенотипический спектр мутаций COL2A1. Хум Мутат  26: 36–43. дои: 10.1002/humu.20179
[7] Барат-Хуари М., Саррабей Г., Гатинуа В. и др. (2016) Обновление мутаций для вариантов гена COL2A1 , связанных с коллагенопатиями типа II. Хум Мутат  37: 7–15. дои: 10.1002/гуму.22915
[8] Рукавина И., Мортье Г., Ван Лаер Л. и др. (2014)Мутация в гене коллагена II типа (COL2AI) как причина первичного остеоартрита, связанного с легким поражением спондилоэпифиза. Semin Arthritis Rheum  44: 101-104. doi: 10.1016/j.semarthrit.2014.03.003
[9] Назме Н.И., Султана Дж., Чоудхури Р.Б. (2016) Синдром Эскобара — история болезни новорожденного. Бангладеш J Child Heal  39: 50–53. дои: 10.3329/bjch.v39i1.28359
[10] Exome Variant Server, NHLBI, 2014 г. Доступно по адресу: https://evs.gs.washington.edu/EVS/.
[11] Тафахори А., Ю Джин Нг А., Тохари С. и др.(2016) Мутация мерцания в большой иранской семье с прогрессирующей наружной офтальмоплегией, миопатией, дисфагией и дисфонией, а также изменением поведения. Arch Iran Med  19: 87-91.
[12] Zhang X, Minikel EV, O’Donnell-Luriaa AH, et al. (2017) Анализ данных ClinVar. Wellcome Open Res  2: 33. doi: 10.12688/wellcomeopenres.11640.1
[13] Fokkema IFAC, Taschner PEM, Schaafsma GCP и др. (2011) LOVD v.2.0: Новое поколение баз данных вариантов генов. Hum Mutat  32: 557–563. дои: 10.1002/humu.21438
[14] Karczewski KJ, Francioli LC, Tiao G, et al.(2020) Спектр мутационных ограничений, количественно определенный по вариациям у 141 456 человек. Природа  581: 434-443. дои: 10.1038/s41586-020-2308-7
[15] Лек М., Карчевский К.Ю., Миникель Э.В. и соавт. (2016) Анализ генетической изменчивости, кодирующей белок, у 60 706 человек. Природа  536: 285-291. дои: 10.1038/природа19057
[16] Karczewski KJ, Weisburd B, Thomas B, et al. (2017) Браузер ExAC: отображение информации о справочных данных из более чем 60 000 экзомов. Nucleic Acids Res  45: D840-845. дои: 10.1093/нар/gkw971
[17] Ричардс С., Азиз Н., Бэйл С. и др.(2015) Стандарты и рекомендации по интерпретации вариантов последовательностей: совместная согласованная рекомендация Американского колледжа медицинской генетики и геномики и Ассоциации молекулярной патологии. Genet Med  17: 405-424. doi: 10.1038/gim.2015.30
[18] Сим Н.Л., Кумар П., Ху Дж. и др.(2012) Веб-сервер SIFT: Прогнозирование влияния аминокислотных замен на белки. Nucleic Acids Res  40: W452-457. дои: 10.1093/нар/gks539
[19] Аджубей И.А., Шмидт С., Пешкин Л. и соавт. (2010) Метод и сервер для прогнозирования повреждающих миссенс-мутаций. Nat Methods  7: 248–249.DOI: 10.1038/nmeth0410-248
[20] Grantham R (1974) Формула различия аминокислот, помогающая объяснить эволюцию белка. Наука  185: 862-864. doi: 10.1126/наука.185.4154.862
[21] Джагадиш К.А., Венгер А.М., Бергер М.Дж. и др.(2016) M-CAP устраняет большинство вариантов неопределенной значимости в клинических экзомах при высокой чувствительности. Нат Жене  48: 1581–1586. дои: 10.1038/ng.3703
[22] Поллард К.С., Хубиш М.Дж., Розенблюм К.Р. и соавт. (2010) Обнаружение ненейтральных скоростей замещения в филогениях млекопитающих. Genome Res  20: 110–121.дои: 10.1101/гр.097857.109
[23] Schwarz JM, Cooper DN, Schuelke M, et al. (2014) Mutationtaster2: предсказание мутаций для возраста глубокого секвенирования. Nat Methods  11: 361-362. doi: 10.1038/nmeth.2890
[24] Кырессаар Т., Лепаметс М., Каплински Л. и др.(2018) Primer3-masker: интеграция маскирования последовательности шаблона с программным обеспечением для разработки праймеров. Биоинформатика  34: 1937–1938. doi: 10.1093/биоинформатика/bty036
[25] Корпет Ф. (1988) Множественное выравнивание последовательностей с иерархической кластеризацией. Nucleic Acids Res  16: 10881-10890. дои: 10.1093/нар/16.22.10881
[26] Лю Ю.Ф., Чен В.М., Лин Ю.Ф. и др. (2005) Варианты гена коллагена II типа и наследственный остеонекроз головки бедренной кости. N Engl J Med  352: 2294-2301. дои: 10.1056/NEJMoa042480
[27] Барат-Хуари М., Дюмон Б., Фабр А. и др.(2016)Расширяющийся спектр вариантов гена COL2A1 у 136 пациентов с фенотипом скелетной дисплазии. Eur J Hum Genet  24: 992-1000. дои: 10.1038/ejhg.2015.250
[28] Terhal PA, Nievelstein RJAJ, Verver EJJ, et al. (2015) Изучение клинических и радиологических особенностей в группе из 93 пациентов с мутацией COL2A1, вызывающей врожденную спондилоэпифизарную дисплазию или родственный фенотип. Am J Med Genet Part A  167: 461-475. дои: 10.1002/ajmg.a.36922
[29] Husar-Memmer E, Ekici A, Al Kaissi A, et al. (2013) Преждевременный остеоартрит как признак коллагенопатии типа II: отчет о болезни и обзор литературы. Semin Arthritis Rheum  42: 355–360. doi: 10.1016/j.семартрит.2012.05.002
[30] Аль Кайсси А., Лакконе Ф., Карнер С. и др. (2013)Дисплазия тазобедренного сустава и остеохондрит позвоночника (болезнь Шейерманна) у девочки с II типом, проявляющейся коллагенопатией. Ортопад  42: 963-968. дои: 10.1007/s00132-013-2182-1
[31] Chen J, Ma X, Zhou Y и др.(2017) Рекуррентная мутация c.G1636A (p.G546S) COL2A1 в китайской семье со скелетной дисплазией и различными метафизарными изменениями: отчет о клиническом случае. BMC Pediatr  17: 175. doi: 10.1186/s12887-017-0930-9
[32] Андерсон К.Э., Силленс Д.О., Лахман Р.С. и соавт. (1982)Спондилометеэпифизарная дисплазия, тип Струдвика. Am J Med Genet  13: 243-256. дои: 10.1002/ajmg.1320130304

Ингибирование пути синтеза серина сочетается с ограничением серина и глицина в рационе для лечения рака

Клеточная культура

Все линии клеток человека, использованные в этом исследовании, были получены от Crick Cell Services. Все клеточные линии прошли стандартный контроль качества, который включал обнаружение микоплазмы, профилирование STR и идентификацию видов для проверки.Клетки культивировали при 37 °C во влажной атмосфере с 5% CO 2 . Клетки HT-29, SW48, SW480, SW620, CACO2, HCT116, RKO, VACO5 и MDA-MB-468 культивировали в среде DMEM (Gibco, 41966) с добавлением 10% FBS; Клетки DLD-1, HCT-15 и SW1417 культивировали в среде RPMI 1640 (Gibco, 21875) с добавлением 10% FBS, а клетки LoVo и CL-34 культивировали в среде DMEM/F12 (Gibco, 11320) с добавлением 10% FBS.

Депривация серина и глицина

Для всех экспериментов по депривации серина и глицина клетки культивировали в МЕМ (Gibco, 21090) с добавлением 10% диализированного FBS (Hyclone, Thermo Scientific), 1% пенициллина-стрептомицина, d-глюкозы ( 5 мМ), пируват натрия (65 мкМ), 1X раствор витамина МЕМ (Gibco, 11120), l-глутамин (2 мМ), l-пролин (0.15 мМ), 1-аланин (0,15 мМ), 1-аспарагиновая кислота (0,15 мМ), 1-глутаминовая кислота (0,15 мМ) и 1-аспарагин (0,34 мМ) (среда -SG). Полная среда (СМ) соответствует ранее описанной среде с добавлением 0,4 мМ l-серина и 0,4 мМ l-глицина.

Кривые роста

Клетки (от 2 × 10 4 до 3 × 10 4 клеток/лунку в зависимости от клеточных линий) высевали в 24-луночные планшеты в их обычной среде. На следующий день после промывания PBS клетки переносили в среду -SG или CM и обрабатывали 10 мкМ PH755 (RAZE Therapeutics), разведенным в ДМСО или только ДМСО.Для стадии подсчета клетки обрабатывали трипсином, суспендировали в PBS-EDTA и подсчитывали с помощью счетчика клеток CASY Model TT (Innovatis, Roche Applied Science). Относительное количество клеток в каждый момент времени рассчитывали на основе количества клеток, измеренного до смены среды. Для эксперимента с кривой роста с добавлением формиата и глицина клетки HT-29, HCT116 и DLD-1 высевали в 24-луночные планшеты (2 × 10 4 клеток/лунку). Формиат натрия (Fluka Analytical, 71540) (1 мМ) и/или глицин (0.4  мМ) разводили в среде -SG + 10 мкМ PH755, и среду обновляли каждые два дня.

Органоиды

Крипты были выделены из аденоматозной тонкой кишки, полученные из Vil1-Creer; APC FL / FL 6 и Vil1-Creer; APC FL ; KRAS 6 ; Крас ; Мыши G12D/+ , как описано ранее 17 . Создание органоида Apc5 , несущего укороченную мутацию Apc , с использованием технологии CRISPR/Cas9 и выделение нормальных органоидов, полученных из проксимальной части здоровой тонкой кишки мыши Villin -CreERT2, проводили, как описано ранее 50,51 ,52 .Генерация четырех колоректальных органоидов, полученных от пациентов, используемых в этом исследовании, была описана ранее 32 . Раковые органоиды мышей культивировали в опухолевой органоидной среде (CM), состоящей из Advanced DMEM/F12 (Gibco, 12634) с добавлением 1% раствора пенициллина-стрептомицина, 0,1% BSA, 2 мМ l-глютамина, 10 мМ Hepes, 50 нг/мл. мл EGF (PeproTech AF-100-15), 100 нг/мл Noggin (PeproTech 250-38), 500 нг/мл спондина (PeproTech 120-38), 1X добавка N-2 (ThermoFisher 17502048) и 1X добавка B-27 (ТермоФишер 17504044).Среда -SG соответствует ранее описанной среде без серина и глицина. Нормальные органоиды мышей выращивали в среде нормальных органоидов, модификации среды опухолевых органоидов с добавлением 100 нг/мл Wnt-3a (R&D systems, 5036-WN), 1 мМ N -ацетил-l-цистеина (Sigma , A7250), 10 мкМ Y-27632 (Sigma, Y0503) и 4  мМ никотинамида (Sigma, N0636). Органоиды человека выращивали в органоидной среде человека, второй модификации среды опухолевых органоидов, в которую добавляли 10 нМ FGF-basic (PeproTech, 100-18B), 100 нг/мл Wnt-3a (R&D systems, 5036-WN), 1 мкМ простагландина E2 (Tocris, 2296), 4 мМ никотинамида (Sigma, N0636), 20 нг/мл HGF (PeproTech, 100-39), 10 нМ FGF-10 (PeproTech, 100-26), 10 нМ гастрина I (Sigma , G9145), 10 мкМ Y-27632 (Sigma, Y0503), 0.5 мкМ A 83-01 (Tocris, 2939) и 5 ​​мкМ SB 202190 (Sigma, S7067). На этапе расщепления органоиды собирали с помощью механического пипетирования с использованием TrypLE (Gibco, A12177-01), инкубировали в течение 10 минут при 37 °C, разбавляли в три раза по объему охлажденным льдом 1X HBSS (Gibco, 14175-053) и центрифугировали. вниз при 270× г в течение 5 мин при 4 °C. Затем осадок ресуспендировали в Matrigel с пониженным содержанием фактора роста (Corning, 356231) и высевали в 24-луночные планшеты. Затем матригель инкубировали в течение 15 мин при 37°С и добавляли 1 мл СМ, описанного выше.На следующий день органоиды промывали PBS, а среду заменяли средой CM или -SG с добавлением или без добавления 10 мкМ PH755 и позволяли расти. Снимки регулярно делались с помощью светового микроскопа (Zeiss, Axiovert 40 CFL) с использованием Infinity Capture (версия 6.5.4), а диаметр органоида измерялся с помощью программного обеспечения ImageJ.

Создание клеток PHGDH KO

Вектор pLentiCRISPRv2, содержащий следующую направляющую РНК: TGGACGAAGGCGCCCTGCTC, был приобретен у Genscript для целевого PHGDH .Клетки HEK293T трансфицировали этой лентивирусной плазмидой вместе с psPAX2 (Addgene, 12260) и VSV.G (Addgene, 14888) с использованием реактива jetPRIME (трансфекция Polyplus). Через 24 ч инкубации среду меняли, а через 48 ч среду, содержащую вирусные частицы, фильтровали (0,45 мм) и смешивали с полибреном (4 мкг/мл, Sigma-Aldrich). Среду, содержащую лентивирусы, инкубировали с клетками-мишенями в течение 24 часов. Затем клетки HT-29 и DLD-1 отбирали с помощью пуромицина (Sigma-Aldrich) в течение 3 недель и анализировали на потерю экспрессии PHGDH.

Трансфекция siRNA ATF-4

siRNA, используемая для подавления человеческого ATF-4, и нецелевой контроль siRNA были приобретены у Dharmacon (пул siRNA siGENOME SMART). Клетки трансфицировали миРНК с использованием реагента для трансфекции Lullaby (OZ Biosciences) в соответствии с инструкциями производителя.

Окрашивание BrdU/7-AAD

Клетки HCT116 и DLD-1 выращивали в течение 48 ч в среде -SG или CM и обрабатывали 10 мкМ PH755, разведенным в ДМСО или только ДМСО. Чтобы определить процент клеток, положительных на бромдезоксиуридин (BrdU), 10 мкМ BrdU затем добавляли к культуральной среде еще на 5 часов, а для анализа клеточного цикла 10 мкМ BrdU добавляли только на 30 минут.Затем клетки собирали, фиксировали и окрашивали антителом APC против BrdU (и 7-AAD для анализа клеточного цикла) с использованием набора APC BrdU Flow (BD Pharmingen, номер по каталогу: 552598) в соответствии с инструкциями производителя. Флуоресценцию получали с помощью FACSdiva на проточном цитометре Fortessa, а анализ выполняли с помощью FlowJo (версия 10.5.2).

Вестерн-блоттинг

Белковые лизаты обрабатывали в RIPA-буфере (Millipore) с добавлением смеси ингибиторов фосфатазы (Thermo Fisher Scientific) и полных ингибиторов протеаз (Roche).Лизаты разделяли с использованием готовых гелей NuPAGE 4–12% Bis-Tris Protein (Invitrogen) и переносили на нитроцеллюлозные мембраны. После инкубации с первичными антителами для обнаружения белков использовали соответствующие вторичные антитела. Вестерн-блоты сканировали с помощью инфракрасного сканера LI-COR Odyssey (изображение с использованием программного обеспечения LI-COR Image Studio Lite версии 5.2.5) или визуализировали с использованием наборов для обнаружения хемилюминесценции ECL (Pierce). Были использованы следующие первичные антитела: PHGDH (13428), ATF-4 (11815), Phospho-eIF2α (Ser51) (3398), киназа Phospho-p70S6 (Thr389) (9234), киназа p70S6 (9202), c-Myc ( 5605), HIF1α (14179), каспаза-3 (9662), расщепленная каспаза-3 (Asp175) (9661), бета-актин (4970) от Cell Signaling Technology; GCN2 (sc-374609), eIF2α (sc-133132), p53 (sc-126), винкулин (sc-73614) от Santa Cruz Biotechnology; PSAT (ab96136), PSPH (ab96414), Phospho-GCN2 (Thr899) (ab75836) от Abcam; ASNS (HPA029318) от Atlas Antibodies; Пуромицин (MABE343) от Sigma-Aldrich.Все первичные антитела разводили в разведении 1:1000, кроме антитела к пуромицину (1:20000). Необрезанные и необработанные сканы наиболее важных блотов представлены в файле исходных данных.

Синтез и расщепление белка

Клетки выращивали в течение 24 ч в среде -SG или CM и обрабатывали 10 мкМ PH755, разведенным в ДМСО или только ДМСО. Для оценки синтеза белка в каждую лунку добавляли пуромицин (конечная концентрация: 90 мкМ) за 10 мин до сбора клеток для вестерн-блоттинга, за исключением лунки с отрицательным контролем.Там, где указано, клетки, выращенные в среде CM, обрабатывали циклогексимидом (10 мкг/мл) в течение последних 5 часов, обеспечивая контроль ингибирования трансляции. Включение пуромицина во вновь синтезированные белки оценивали вестерн-блоттингом с использованием антитела против пуромицина (Sigma-Aldrich, MABE343). Для оценки накопления короткоживущих белков в ответ на ингибирование протеасом клетки, выращенные в среде -SG или CM плюс или минус 10 мкМ PH755 в течение 24 ч, обрабатывали в течение последних 6 ч ингибитором протеасом MG-132 (10 мкМ). перед сбором клеток для вестерн-блоттинга.

qPCR

Клетки HT-29, HCT116 и DLD-1 выращивали в течение 6 ч или 24 ч в среде -SG или CM и обрабатывали 10 мкМ PH755, разведенным в ДМСО или только ДМСО. Суммарную РНК экстрагировали с использованием набора RNeasy Mini (Qiagen, № по каталогу: 74104), выполняя расщепление ДНК на колонке (Qiagen, набор ДНКаз без РНКазы, № по каталогу: 79254) и подвергали обратной транскрипции с использованием высокопроизводительного набора для обратной транскрипции кДНК. комплект (Thermofisher, номер по каталогу: 4368814) в соответствии с инструкциями производителя. КПЦР проводили с использованием мастер-микса PrimeTime Gene Expression Master Mix (IDT, каталожный номер: 1055771) с праймерами, перечисленными в дополнительной таблице 1.Для всех реакций использовали систему ПЦР в реальном времени QuantStudio 7 Flex (программное обеспечение версии 1.3). Экспрессию гена нормализовали по ACTB (β-актин) гену домашнего хозяйства, анализировали по методу Pfaffl 53 и выражали в относительных единицах по сравнению с клетками, выращенными в CM в течение 6 часов.

Жидкостная хроматография-масс-спектрометрия

Клетки HT-29 (2,4 × 10 5 ), клетки HCT116 (1,8 × 10 5 ), клетки DLD-1 (1,8 × 10 5 ), клетки DLD-1 (1,8 × × 4 5MB-10 9006 468 ячеек (2.4 × 10 5 ) высевали в шестилуночные планшеты в обычной среде. Дублирующие планшеты использовали для подсчета клеток, чтобы нормализовать анализ ЖХ-МС на основе количества клеток. Через 16 часов клетки промывали PBS и переносили в среду CM или -SG с добавлением или без добавления 10 мкМ PH755 на 24 часа. Всего за 6 часов до экстракции метаболитов среду заменяли средой CM или -SG ±10 мкМ PH755 с глюкозой, замененной на 10 мМ U-[ 13 C]-глюкозы (Cambridge Isotopes). Для краткосрочных экспериментов клетки переносили в описанную ранее среду с глюкозой, замещенной 10 мМ U-[ 13 C]-глюкозой, только на 3 или 6 часов перед экстракцией метаболитов.Для измерения превращения глицина в серин во время эксперимента по спасению клетки выращивали в течение 24 ч в среде -SG с добавлением 10 мкМ PH755, 1 мМ формиата натрия и 0,4 мМ глицина. Затем эту среду заменяли соответствующей средой с заменой глицина на 0,4 мМ 13 C 2 15 N 1 -глицина в течение 1 ч перед экстракцией метаболита. Для половины образцов в среду добавляли 1 мМ немеченого серина в импульсном режиме за 1 мин до экстракции метаболита, чтобы обеспечить накопление меченого серина.Затем клетки промывали PBS и метаболиты экстрагировали с использованием ледяного экстракционного буфера, состоящего из метанола, ацетонитрила и H 2 O в следующем соотношении 50:30:20. Для анализа образцов опухолей методом ЖХ-МС ткань гомогенизировали (20–40 мг ткани/мл ранее описанного буфера для экстракции) с использованием гомогенизатора Precellys 24 (Bertin Instruments). Образцы центрифугировали (16000× г /10 мин/0 °C) и супернатант собирали для повторного центрифугирования (16000× г /10 мин/0 °C).Затем собирали супернатант для анализа ЖХ-МС. Для ЖХ-МС анализа плазмы мышей плазму разбавляли в 20–50 раз тем же буфером для экстракции, встряхивали в течение 30 с и центрифугировали (16 000× г /10 мин/0 °C). Затем собирали супернатант для анализа. Абсолютные уровни серина и глицина в плазме определяли с помощью 8-точечных калибровочных кривых (от 2,5 до 800 мкМ) с 13 C 3 15 N 1 -серин и 13

  • 2
  • C

    5 3 15 N 1 -глицин, разведенный в плазме.Анализ ЖХ-МС проводили, как описано ранее 9 . Данные регистрировали с помощью программного обеспечения Xcalibur 4.0.27.19 (Thermo Scientific). Проверка качественных отнесений пиков проводилась с помощью Qual Browser из Xcalibur 4.0.27.19, а интеграция пиков метаболитов выполнялась с использованием TraceFinder 4.1.

    Эксперименты in vivo

    Все исследования на животных проводились в соответствии с лицензиями на проекты, утвержденными Министерством внутренних дел Великобритании (Закон о животных (научные процедуры) 1986 г. и Директива ЕС 2010 г.).Эксперименты на животных подлежат этической экспертизе со стороны Фрэнсиса Крика, органа по защите животных и этической экспертизы, и проводятся в соответствии с проектной лицензией Министерства внутренних дел Великобритании P319AE968 или Институтом Битсона CRUK (рассмотрено и одобрено Университетом Глазго и Министерством внутренних дел Великобритании). в соответствии с лицензией на проект Министерства внутренних дел Великобритании 70/8645. Мышам (3–5 в клетке) давали свободный доступ к пище и воде и содержали в 12-часовом цикле день/ночь, начиная с 7:00 до 19:00. Комнаты содержались при температуре 21 °C и влажности 55%.Мышам давали возможность акклиматизироваться в течение по крайней мере 1 недели до эксперимента. Затем они были случайным образом распределены по экспериментальным группам. Экспериментальные диеты, использованные в этом исследовании (контрольная диета и диета с SG), ранее были описаны как «Рацион 1-Контроль» и «Рацион 1 без SG» 17 . Вкратце, контрольная диета содержит все незаменимые аминокислоты, а также серин, глицин, глютамин, аргинин, цистин и тирозин. Рацион -SG аналогичен контрольному рациону, но лишен серина и глицина, что компенсируется пропорционально повышенным уровнем других аминокислот для достижения такого же общего содержания аминокислот.

    Эксперименты с ксенотрансплантатом

    Самки голых мышей CD-1 (полученные из Charles River, возраст 7–9 недель) получали односторонние подкожные инъекции 100 мкл клеток HCT116 (2 × 10 6 клеток) или 100 мкл DLD-1 клетки (4 × 10 6 клеток), суспендированные в PBS. Мышей помещали на экспериментальную диету (контроль или -SG) через 10 дней (для эксперимента с ксенотрансплантатом HCT116) или через 2 дня (для эксперимента с ксенотрансплантатом DLD-1) после инъекций опухоли. Всего через 4 дня (для эксперимента с ксенотрансплантатом HCT116) или через 2 дня (для эксперимента с ксенотрансплантатом DLD-1) после изменения диеты мышам вводили либо носитель (0.5% метилцеллюлоза (Sigma, H7509), 0,5% Tween-80 (Sigma, P8192)) или PH755 (полученный от Raze Therapeutics), приготовленные в носителе один раз в день через пероральный зонд. Начальная доза PH755 составляла 100 мг/кг и впоследствии была снижена до 75 мг/кг или 50 мг/кг, как указано в подписях к рисункам. Подкожный рост измеряли штангенциркулем два-три раза в неделю, и для расчета объема опухоли использовали следующую формулу: длина × ширина 2 /2.

    Эксперимент C57BL/6J

    Самцов мышей C57BL/6J (полученных из Charles River, возраст 14 недель) помещали на экспериментальную диету (контрольную или -SG) за 2 дня до начала лечения PH755 или его носителем.Мышей лечили один раз в день через желудочный зонд PH755 или его носителем в течение 20 дней. Начальная доза PH755 составляла 75 мг/кг и впоследствии была снижена до 50 мг/кг, чтобы поддерживать потерю веса ниже 20% от исходной массы тела.

    Иммуногистохимия

    Все ткани фиксировали в 10% нейтральном забуференном формалине и заливали в парафин. Для окрашивания PHGDH и PSAT1 предметные стекла депарафинизировали в ксилоле и регидратировали с использованием ряда растворов промышленного денатурата и дистиллированной воды.Извлечение антигена проводили в течение 23 мин в микроволновой печи с использованием 0,1 М цитратного буфера с рН 6. Блокирование эндогенной пероксидазы осуществляли с использованием 1,6% H 2 O 2 в течение 10 минут при комнатной температуре, а блокирование белков осуществляли с использованием 2,5% нормальной лошадиной сыворотки (MP-7401, Vector) в течение ночи при 4°C. Первичное антитело разводили в соотношении 1:1000 для антитела PHGDH (HPA021241, Sigma-Aldrich) и в отношении 1:500 для антитела PSAT1 (PA5-22124, Thermofisher) в 1% BSA и инкубировали в течение 1 часа при комнатной температуре.Полимер HRP Horse Anti-Rabbit IgG (MP-7401, Vector) инкубировали в течение 30 минут при комнатной температуре. Хромоген 3,3-диаминобензидина (DAB) (SK-4100, Vector) инкубировали в течение 10 мин при комнатной температуре. Предметные стекла были контрастно окрашены гематоксилином Harris, обезвожены, очищены и помещены в автоматический краситель Sakura Tissue-Tek Prisma®. Для количественной оценки интенсивности окрашивания PHGDH и PSAT1 количественно определяли минимум три поля на опухоль, как описано в Crowe et al. 54 с ImageJ. Иммуногистохимию активной каспазы-3 проводили на платформе Discovery Ultra Ventana (от Roche).Извлечение антигена проводили с помощью Cell Conditioning 1 (CC1) от Ventana Medical Systems. Первичное антитело (AF835, R&D Systems) разводили в соотношении 1:1250 и инкубировали в течение 60 мин. Для окрашивания активной каспазы-3 количественно определяли минимум три поля на опухоль с помощью алгоритма обнаружения положительных клеток от QuPath (версия 0.1.2). Все слайды были отсканированы с помощью сканера слайдов ZEISS Axio Scan.Z1, а изображения были созданы с помощью программного обеспечения ZEISS ZEN 2.6 (blue edition). Для рулонов кишки иммуногистохимию выполняли на Bond Rx Autostainer от Leica Biosystems с использованием набора для окрашивания Leica Bond Intense R.Предметные стекла депарафинизировали с помощью Bond Dewax при 72°С в течение 30 мин, а выделение антигена осуществляли с помощью ER2 при 100°С в течение 20 мин. Первичное антитело (Ki67 SP6, ab16667, Abcam) разводили в соотношении 1/100 и инкубировали в течение 35 мин. Для измерения длины ворсинок с помощью ImageJ измеряли ворсинки из той же области тонкой кишки (не менее 15 на мышь) от соединения крипта/ворсинка до кончика ворсинки.

    Взятие проб головного мозга и патологическое исследование

    Мышей C57BL/6J забивали с помощью удушения углекислым газом, чтобы избежать физической травмы головного мозга.Мышей немедленно препарировали и с поверхности черепа удаляли волосатую кожу и мягкие ткани. Были выполнены разрезы по всему теменному и лобному швам, чтобы обеспечить быстрое проникновение фиксирующего раствора в паренхиму головного мозга. Голову погружали в 250 мл 10% нейтрального забуференного формалина и фиксировали на 2 недели. После полной фиксации мозг удаляли из черепа и обрезали, используя матрицу мозга мыши (BSMYS001-1; Zivic Instruments, Питтсбург, Пенсильвания). Были получены четыре коронарных среза на уровне грушевидной коры, каудального промежуточного мозга, каудального среднего мозга и рострального мозжечка.Образцы тканей обычно обрабатывали для заливки парафином, делали срезы толщиной 4 мкм и окрашивали гематоксилином и эозином. Гистопатологические критерии, описанные в диагностической схеме INHAND, использовались для выявления возможных микроскопических изменений 55 . Гистопатологическое исследование головного мозга проводилось сертифицированным ветеринарным патологоанатомом.

    Анализы биохимических маркеров крови

    Активность АЛТ и АСТ в плазме измеряли с помощью набора для анализа активности аланинтрансаминазы (Abcam, № по каталогу: ab105134) и набор для анализа активности AST (Sigma-Aldrich, номер по каталогу: MAK055-1KT) соответственно в соответствии с инструкциями производителя.

    Статистический анализ

    Все данные выражены как среднее ± SEM, и каждый статистический анализ подробно описан в подписи к рисунку. Данные были собраны в Excel (версия 16.16.26), и весь статистический анализ был выполнен с использованием программного обеспечения GraphPad Prism 8 (версия 8.3.1). Для сравнения двух групп друг с другом был проведен непарный тест Стьюдента t .Если дисперсия между двумя группами была неравной, применялась поправка Уэлча. Для сравнения более чем двух групп статистическую значимость определяли с помощью однофакторного ANOVA с тестом множественных сравнений Тьюки. Для анализа объема опухоли и массы тела был проведен двухсторонний ANOVA плюс апостериорный критерий Тьюки. р значение ниже 0,05 считалось статистически значимым. Значимость указана следующим образом: * p  < 0,05, ** p  < 0,01, *** p  < 0.001, **** p  < 0,0001, нс: не имеет значения. Все измерения были взяты из отдельных образцов. Размеры выборки были основаны на стандартных протоколах в полевых условиях, а метаболические образцы были распределены в случайном порядке перед анализом. Мышей случайным образом назначали для лечения, и личность каждой мыши была скрыта при сборе измерений.

    Сводка отчета

    Дополнительную информацию о дизайне исследования можно найти в Сводке отчета об исследовании природы, связанной с этой статьей.

    Переливание крови: Внутривенный иммуноглобулин Руководство

    Инкрементный ставки: 

    повышать каждые 30 минут, только если допустимо

                   1 мл/кг/ч 

                    2 мл/кг/ч 

                   3 мл/кг/ч 

                   4 мл/кг/ч 

                0.6 мл/кг/час  

               1,2 мл/кг/ч

               2,4 мл/кг/ч

               3,6 мл/кг/ч

               4,8 мл/кг/ч 

                            1.2 мл/кг/час

                            1,8 мл/кг/ч 

                            2,4 мл/кг/ч

                            3,0 мл/кг/ч

                            3,6 мл/кг/ч

                            4.2 мл/кг/час

                           4,8 мл/кг/ч

                           5,4 мл/кг/ч

                            6,0 мл/кг/ч 

                            1,2 мл/кг/ч 

                             1.8 мл/кг/ч

                             2,4 мл/кг/ч

                             3,0 мл/кг/ч

                             3,6 мл/кг/ч

                             4,2 мл/кг/ч

                             4.8 мл/кг/ч

    Максимум ставка

                  4 мл/кг/ч

          Максимум 240 мл/ч

               4.

    Добавить комментарий

    Ваш адрес email не будет опубликован.